Problem 1: PCR Primer Design and Validation

You need to amplify a 500 bp region from human BRCA1 for sequencing.

Target region:

ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGT
GTCCCATCTGGTAAGTCAGCACAAGGGCCATGGGACAGAGATTTGGCCAGGTATTACCTGCTGTGACCAT
TGACAAGACCTCTGTGTGAAGGCTTCCTGCCACACAGCAAGCAGTCTCAGATGAGAACAGAAACTGGAAG
AGAAATGGCAGCTGGGCTGAGAGAGCTGAGGGAGCAAGAGAGGAAGCTCTGGGGTCCTCCTCAGAACTCA
ACAAGCACTGCCGCACAGGCAGCAGCTTCCACCTGCTCTTGAATGAAGCAGAGGCCTCTGTGAGTAGGGG
TAGAGAGAAGCTCACTGCCACGGAGTGATGGAACTGGAGGCGCTGAGGATGAGGTCACTGAGACGTCCTA
CCAGGGAGATGAGAACAGAAGGCAGAGAGGCTGATGAAGCTGAGATGGTGGAGAGCTGGGGGAAG

Design forward and reverse primers that meet these criteria:

• Length: 18-24 bp
• Tm: 58-62°C
• GC content: 40-60%
• No hairpins with ΔG < -3 kcal/mol
• No primer dimers with ΔG < -5 kcal/mol

Show hint

**How to find primers:** Use Primer3 (`pip install primer3-py`) to automatically design primers

For Primer3:

import primer3
result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': target},
    global_args={'PRIMER_OPT_SIZE': 20, 'PRIMER_OPT_TM': 60.0, ...}
)

For NUPACK validation:

• Import: Model, Strand, Complex, ComplexSet, SetSpec, complex_analysis
• To check hairpins: analyze a single strand (max_size=1)
• To check dimers: analyze two strands together (max_size=2)
• Access results with: results[Complex([strand])].free_energy

Common issues to avoid:

• Primers with runs of 4+ identical bases
• 3' ends that are self-complementary
• Large Tm difference between forward and reverse (keep within ~5°C)

---

Problem 2: Primer Validation and Troubleshooting

A colleague designed primers for amplifying the same target region from Problem 1, but the PCR isn't working well. You need to diagnose the problems using computational analysis.

Their primers:

Forward:  5'-GCGCGCATGGATTTATCTGCT-3'
Reverse:  5'-GCGCGCCTTCCCCAGCTCTC-3'

Analyze these primers and identify all problems:

1. Check basic properties (length, GC content)
2. Verify they actually bind to the target sequence
3. Check for secondary structures (hairpins)
4. Check for primer dimers
5. Analyze 3' end stability

Common problems with primers:

1. Non-target sequences - Do the primers actually match the target?
2. Tm issues - Are the Tm values reasonable and similar?
3. Secondary structures - Hairpins or dimers?

Show hint

**Analysis steps:** 1. Check if primers bind to target: use Python's `in` operator (don't forget reverse complement!) 2. If they don't match, try removing bases from the 5' end to find what does match 3. Calculate Tm: use the simple formula or Biopython 4. NUPACK hairpin check: single strand with max_size=1 5. NUPACK dimer check: two strands with max_size=2

---

License: © 2025 Matthias Függer and Thomas Nowak. Licensed under CC BY-NC-SA 4.0.